ID: 1180314091

View in Genome Browser
Species Human (GRCh38)
Location 22:11262387-11262409
Sequence GATACCTCTGCATTGGCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180314091_1180314097 -1 Left 1180314091 22:11262387-11262409 CCTCGGGCCAATGCAGAGGTATC No data
Right 1180314097 22:11262409-11262431 CCATTTGACCTCGGTGGGACAGG No data
1180314091_1180314095 -6 Left 1180314091 22:11262387-11262409 CCTCGGGCCAATGCAGAGGTATC No data
Right 1180314095 22:11262404-11262426 GGTATCCATTTGACCTCGGTGGG No data
1180314091_1180314093 -10 Left 1180314091 22:11262387-11262409 CCTCGGGCCAATGCAGAGGTATC No data
Right 1180314093 22:11262400-11262422 CAGAGGTATCCATTTGACCTCGG No data
1180314091_1180314094 -7 Left 1180314091 22:11262387-11262409 CCTCGGGCCAATGCAGAGGTATC No data
Right 1180314094 22:11262403-11262425 AGGTATCCATTTGACCTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180314091 Original CRISPR GATACCTCTGCATTGGCCCG AGG (reversed) Intergenic
No off target data available for this crispr