ID: 1180314346

View in Genome Browser
Species Human (GRCh38)
Location 22:11265010-11265032
Sequence CTTCATTTAGTGAGTCAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180314346_1180314357 8 Left 1180314346 22:11265010-11265032 CCTAACTGACTCACTAAATGAAG No data
Right 1180314357 22:11265041-11265063 ACGTGGGTAGTGGGGGGAGCCGG No data
1180314346_1180314359 10 Left 1180314346 22:11265010-11265032 CCTAACTGACTCACTAAATGAAG No data
Right 1180314359 22:11265043-11265065 GTGGGTAGTGGGGGGAGCCGGGG No data
1180314346_1180314350 -9 Left 1180314346 22:11265010-11265032 CCTAACTGACTCACTAAATGAAG No data
Right 1180314350 22:11265024-11265046 TAAATGAAGGTAAAGGGACGTGG No data
1180314346_1180314352 -2 Left 1180314346 22:11265010-11265032 CCTAACTGACTCACTAAATGAAG No data
Right 1180314352 22:11265031-11265053 AGGTAAAGGGACGTGGGTAGTGG No data
1180314346_1180314361 14 Left 1180314346 22:11265010-11265032 CCTAACTGACTCACTAAATGAAG No data
Right 1180314361 22:11265047-11265069 GTAGTGGGGGGAGCCGGGGCGGG No data
1180314346_1180314356 2 Left 1180314346 22:11265010-11265032 CCTAACTGACTCACTAAATGAAG No data
Right 1180314356 22:11265035-11265057 AAAGGGACGTGGGTAGTGGGGGG No data
1180314346_1180314358 9 Left 1180314346 22:11265010-11265032 CCTAACTGACTCACTAAATGAAG No data
Right 1180314358 22:11265042-11265064 CGTGGGTAGTGGGGGGAGCCGGG No data
1180314346_1180314353 -1 Left 1180314346 22:11265010-11265032 CCTAACTGACTCACTAAATGAAG No data
Right 1180314353 22:11265032-11265054 GGTAAAGGGACGTGGGTAGTGGG No data
1180314346_1180314360 13 Left 1180314346 22:11265010-11265032 CCTAACTGACTCACTAAATGAAG No data
Right 1180314360 22:11265046-11265068 GGTAGTGGGGGGAGCCGGGGCGG No data
1180314346_1180314355 1 Left 1180314346 22:11265010-11265032 CCTAACTGACTCACTAAATGAAG No data
Right 1180314355 22:11265034-11265056 TAAAGGGACGTGGGTAGTGGGGG No data
1180314346_1180314354 0 Left 1180314346 22:11265010-11265032 CCTAACTGACTCACTAAATGAAG No data
Right 1180314354 22:11265033-11265055 GTAAAGGGACGTGGGTAGTGGGG No data
1180314346_1180314351 -8 Left 1180314346 22:11265010-11265032 CCTAACTGACTCACTAAATGAAG No data
Right 1180314351 22:11265025-11265047 AAATGAAGGTAAAGGGACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180314346 Original CRISPR CTTCATTTAGTGAGTCAGTT AGG (reversed) Intergenic
No off target data available for this crispr