ID: 1180314353

View in Genome Browser
Species Human (GRCh38)
Location 22:11265032-11265054
Sequence GGTAAAGGGACGTGGGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180314346_1180314353 -1 Left 1180314346 22:11265010-11265032 CCTAACTGACTCACTAAATGAAG No data
Right 1180314353 22:11265032-11265054 GGTAAAGGGACGTGGGTAGTGGG No data
1180314344_1180314353 3 Left 1180314344 22:11265006-11265028 CCCACCTAACTGACTCACTAAAT No data
Right 1180314353 22:11265032-11265054 GGTAAAGGGACGTGGGTAGTGGG No data
1180314345_1180314353 2 Left 1180314345 22:11265007-11265029 CCACCTAACTGACTCACTAAATG No data
Right 1180314353 22:11265032-11265054 GGTAAAGGGACGTGGGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180314353 Original CRISPR GGTAAAGGGACGTGGGTAGT GGG Intergenic
No off target data available for this crispr