ID: 1180314361 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:11265047-11265069 |
Sequence | GTAGTGGGGGGAGCCGGGGC GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1180314346_1180314361 | 14 | Left | 1180314346 | 22:11265010-11265032 | CCTAACTGACTCACTAAATGAAG | No data | ||
Right | 1180314361 | 22:11265047-11265069 | GTAGTGGGGGGAGCCGGGGCGGG | No data | ||||
1180314345_1180314361 | 17 | Left | 1180314345 | 22:11265007-11265029 | CCACCTAACTGACTCACTAAATG | No data | ||
Right | 1180314361 | 22:11265047-11265069 | GTAGTGGGGGGAGCCGGGGCGGG | No data | ||||
1180314344_1180314361 | 18 | Left | 1180314344 | 22:11265006-11265028 | CCCACCTAACTGACTCACTAAAT | No data | ||
Right | 1180314361 | 22:11265047-11265069 | GTAGTGGGGGGAGCCGGGGCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1180314361 | Original CRISPR | GTAGTGGGGGGAGCCGGGGC GGG | Intergenic | ||
No off target data available for this crispr |