ID: 1180315476

View in Genome Browser
Species Human (GRCh38)
Location 22:11273764-11273786
Sequence GGTTCCAGACAACCACAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180315471_1180315476 14 Left 1180315471 22:11273727-11273749 CCAAAAACCTACAAGCATTCTCA No data
Right 1180315476 22:11273764-11273786 GGTTCCAGACAACCACAATAAGG No data
1180315472_1180315476 7 Left 1180315472 22:11273734-11273756 CCTACAAGCATTCTCAGAGATAG No data
Right 1180315476 22:11273764-11273786 GGTTCCAGACAACCACAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180315476 Original CRISPR GGTTCCAGACAACCACAATA AGG Intergenic
No off target data available for this crispr