ID: 1180317049

View in Genome Browser
Species Human (GRCh38)
Location 22:11284633-11284655
Sequence GTGTGGGTATTGTGAGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180317049_1180317058 20 Left 1180317049 22:11284633-11284655 CCTTTTTCTCACAATACCCACAC No data
Right 1180317058 22:11284676-11284698 AGGACCCGCCCGTGGCCAACGGG No data
1180317049_1180317057 19 Left 1180317049 22:11284633-11284655 CCTTTTTCTCACAATACCCACAC No data
Right 1180317057 22:11284675-11284697 GAGGACCCGCCCGTGGCCAACGG No data
1180317049_1180317061 25 Left 1180317049 22:11284633-11284655 CCTTTTTCTCACAATACCCACAC No data
Right 1180317061 22:11284681-11284703 CCGCCCGTGGCCAACGGGACAGG No data
1180317049_1180317053 0 Left 1180317049 22:11284633-11284655 CCTTTTTCTCACAATACCCACAC No data
Right 1180317053 22:11284656-11284678 CATCGTCGCTTGTCCCAACGAGG No data
1180317049_1180317054 12 Left 1180317049 22:11284633-11284655 CCTTTTTCTCACAATACCCACAC No data
Right 1180317054 22:11284668-11284690 TCCCAACGAGGACCCGCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180317049 Original CRISPR GTGTGGGTATTGTGAGAAAA AGG (reversed) Intergenic
No off target data available for this crispr