ID: 1180319857

View in Genome Browser
Species Human (GRCh38)
Location 22:11309967-11309989
Sequence CATCCCCACTTCAGTCTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180319857_1180319858 14 Left 1180319857 22:11309967-11309989 CCTCAAAGACTGAAGTGGGGATG No data
Right 1180319858 22:11310004-11310026 TTGTTGTTTACCTGTCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180319857 Original CRISPR CATCCCCACTTCAGTCTTTG AGG (reversed) Intergenic
No off target data available for this crispr