ID: 1180319858

View in Genome Browser
Species Human (GRCh38)
Location 22:11310004-11310026
Sequence TTGTTGTTTACCTGTCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180319857_1180319858 14 Left 1180319857 22:11309967-11309989 CCTCAAAGACTGAAGTGGGGATG No data
Right 1180319858 22:11310004-11310026 TTGTTGTTTACCTGTCACCCAGG No data
1180319853_1180319858 28 Left 1180319853 22:11309953-11309975 CCAGGTCTGTCTAACCTCAAAGA No data
Right 1180319858 22:11310004-11310026 TTGTTGTTTACCTGTCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180319858 Original CRISPR TTGTTGTTTACCTGTCACCC AGG Intergenic
No off target data available for this crispr