ID: 1180321530

View in Genome Browser
Species Human (GRCh38)
Location 22:11325884-11325906
Sequence GCCTCGGTTTTGTAGTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180321530_1180321534 14 Left 1180321530 22:11325884-11325906 CCAGGCTACTACAAAACCGAGGC No data
Right 1180321534 22:11325921-11325943 TGACAATATGTAGAGCACTCAGG No data
1180321530_1180321536 20 Left 1180321530 22:11325884-11325906 CCAGGCTACTACAAAACCGAGGC No data
Right 1180321536 22:11325927-11325949 TATGTAGAGCACTCAGGTGAGGG No data
1180321530_1180321532 -9 Left 1180321530 22:11325884-11325906 CCAGGCTACTACAAAACCGAGGC No data
Right 1180321532 22:11325898-11325920 AACCGAGGCGGTGAGCAGAAAGG No data
1180321530_1180321535 19 Left 1180321530 22:11325884-11325906 CCAGGCTACTACAAAACCGAGGC No data
Right 1180321535 22:11325926-11325948 ATATGTAGAGCACTCAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180321530 Original CRISPR GCCTCGGTTTTGTAGTAGCC TGG (reversed) Intergenic