ID: 1180323704

View in Genome Browser
Species Human (GRCh38)
Location 22:11348255-11348277
Sequence AGGGAGAGCACAGTGACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180323704_1180323714 26 Left 1180323704 22:11348255-11348277 CCTCCAGTCACTGTGCTCTCCCT No data
Right 1180323714 22:11348304-11348326 TTGTGTGGCTGCTGCTAGGTGGG No data
1180323704_1180323712 22 Left 1180323704 22:11348255-11348277 CCTCCAGTCACTGTGCTCTCCCT No data
Right 1180323712 22:11348300-11348322 TGTGTTGTGTGGCTGCTGCTAGG No data
1180323704_1180323706 -7 Left 1180323704 22:11348255-11348277 CCTCCAGTCACTGTGCTCTCCCT No data
Right 1180323706 22:11348271-11348293 TCTCCCTCTCCCAAATTCACAGG No data
1180323704_1180323713 25 Left 1180323704 22:11348255-11348277 CCTCCAGTCACTGTGCTCTCCCT No data
Right 1180323713 22:11348303-11348325 GTTGTGTGGCTGCTGCTAGGTGG No data
1180323704_1180323711 11 Left 1180323704 22:11348255-11348277 CCTCCAGTCACTGTGCTCTCCCT No data
Right 1180323711 22:11348289-11348311 ACAGGTTTCTCTGTGTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180323704 Original CRISPR AGGGAGAGCACAGTGACTGG AGG (reversed) Intergenic