ID: 1180329242

View in Genome Browser
Species Human (GRCh38)
Location 22:11461668-11461690
Sequence GGTCTGACTGTCCCTCACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180329242_1180329243 -5 Left 1180329242 22:11461668-11461690 CCTATGTGAGGGACAGTCAGACC No data
Right 1180329243 22:11461686-11461708 AGACCACAGCAGCAATGTTATGG No data
1180329242_1180329245 9 Left 1180329242 22:11461668-11461690 CCTATGTGAGGGACAGTCAGACC No data
Right 1180329245 22:11461700-11461722 ATGTTATGGAATCCTATTTGAGG No data
1180329242_1180329247 11 Left 1180329242 22:11461668-11461690 CCTATGTGAGGGACAGTCAGACC No data
Right 1180329247 22:11461702-11461724 GTTATGGAATCCTATTTGAGGGG No data
1180329242_1180329246 10 Left 1180329242 22:11461668-11461690 CCTATGTGAGGGACAGTCAGACC No data
Right 1180329246 22:11461701-11461723 TGTTATGGAATCCTATTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180329242 Original CRISPR GGTCTGACTGTCCCTCACAT AGG (reversed) Intergenic
No off target data available for this crispr