ID: 1180331388

View in Genome Browser
Species Human (GRCh38)
Location 22:11484103-11484125
Sequence ATGGACAAAGAAGCTTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180331383_1180331388 17 Left 1180331383 22:11484063-11484085 CCTCATAGATGGTGCCAGCTATA No data
Right 1180331388 22:11484103-11484125 ATGGACAAAGAAGCTTCCTTTGG No data
1180331387_1180331388 -9 Left 1180331387 22:11484089-11484111 CCTCTCATGTTGGAATGGACAAA No data
Right 1180331388 22:11484103-11484125 ATGGACAAAGAAGCTTCCTTTGG No data
1180331384_1180331388 3 Left 1180331384 22:11484077-11484099 CCAGCTATATGTCCTCTCATGTT No data
Right 1180331388 22:11484103-11484125 ATGGACAAAGAAGCTTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180331388 Original CRISPR ATGGACAAAGAAGCTTCCTT TGG Intergenic
No off target data available for this crispr