ID: 1180331389

View in Genome Browser
Species Human (GRCh38)
Location 22:11484119-11484141
Sequence GCACTTATGAAAGAGGCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180331389_1180331395 19 Left 1180331389 22:11484119-11484141 CCTTTGGCCTCTTTCATAAGTGC No data
Right 1180331395 22:11484161-11484183 GCTTTGCCATTACATTTCAAAGG No data
1180331389_1180331391 -7 Left 1180331389 22:11484119-11484141 CCTTTGGCCTCTTTCATAAGTGC No data
Right 1180331391 22:11484135-11484157 TAAGTGCACTAATCCCAATCAGG No data
1180331389_1180331392 -3 Left 1180331389 22:11484119-11484141 CCTTTGGCCTCTTTCATAAGTGC No data
Right 1180331392 22:11484139-11484161 TGCACTAATCCCAATCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180331389 Original CRISPR GCACTTATGAAAGAGGCCAA AGG (reversed) Intergenic
No off target data available for this crispr