ID: 1180331390

View in Genome Browser
Species Human (GRCh38)
Location 22:11484126-11484148
Sequence GATTAGTGCACTTATGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180331390_1180331392 -10 Left 1180331390 22:11484126-11484148 CCTCTTTCATAAGTGCACTAATC No data
Right 1180331392 22:11484139-11484161 TGCACTAATCCCAATCAGGATGG No data
1180331390_1180331395 12 Left 1180331390 22:11484126-11484148 CCTCTTTCATAAGTGCACTAATC No data
Right 1180331395 22:11484161-11484183 GCTTTGCCATTACATTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180331390 Original CRISPR GATTAGTGCACTTATGAAAG AGG (reversed) Intergenic
No off target data available for this crispr