ID: 1180331391

View in Genome Browser
Species Human (GRCh38)
Location 22:11484135-11484157
Sequence TAAGTGCACTAATCCCAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180331389_1180331391 -7 Left 1180331389 22:11484119-11484141 CCTTTGGCCTCTTTCATAAGTGC No data
Right 1180331391 22:11484135-11484157 TAAGTGCACTAATCCCAATCAGG No data
1180331387_1180331391 23 Left 1180331387 22:11484089-11484111 CCTCTCATGTTGGAATGGACAAA No data
Right 1180331391 22:11484135-11484157 TAAGTGCACTAATCCCAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180331391 Original CRISPR TAAGTGCACTAATCCCAATC AGG Intergenic
No off target data available for this crispr