ID: 1180331392

View in Genome Browser
Species Human (GRCh38)
Location 22:11484139-11484161
Sequence TGCACTAATCCCAATCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180331390_1180331392 -10 Left 1180331390 22:11484126-11484148 CCTCTTTCATAAGTGCACTAATC No data
Right 1180331392 22:11484139-11484161 TGCACTAATCCCAATCAGGATGG No data
1180331387_1180331392 27 Left 1180331387 22:11484089-11484111 CCTCTCATGTTGGAATGGACAAA No data
Right 1180331392 22:11484139-11484161 TGCACTAATCCCAATCAGGATGG No data
1180331389_1180331392 -3 Left 1180331389 22:11484119-11484141 CCTTTGGCCTCTTTCATAAGTGC No data
Right 1180331392 22:11484139-11484161 TGCACTAATCCCAATCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180331392 Original CRISPR TGCACTAATCCCAATCAGGA TGG Intergenic
No off target data available for this crispr