ID: 1180333619

View in Genome Browser
Species Human (GRCh38)
Location 22:11555828-11555850
Sequence CCGTGGGGCCTCTTATCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180333611_1180333619 15 Left 1180333611 22:11555790-11555812 CCACTCTCGAAACACCCGAGCTT No data
Right 1180333619 22:11555828-11555850 CCGTGGGGCCTCTTATCAGCTGG No data
1180333617_1180333619 -10 Left 1180333617 22:11555815-11555837 CCAGAACAACATGCCGTGGGGCC No data
Right 1180333619 22:11555828-11555850 CCGTGGGGCCTCTTATCAGCTGG No data
1180333609_1180333619 17 Left 1180333609 22:11555788-11555810 CCCCACTCTCGAAACACCCGAGC No data
Right 1180333619 22:11555828-11555850 CCGTGGGGCCTCTTATCAGCTGG No data
1180333613_1180333619 0 Left 1180333613 22:11555805-11555827 CCGAGCTTCACCAGAACAACATG No data
Right 1180333619 22:11555828-11555850 CCGTGGGGCCTCTTATCAGCTGG No data
1180333610_1180333619 16 Left 1180333610 22:11555789-11555811 CCCACTCTCGAAACACCCGAGCT No data
Right 1180333619 22:11555828-11555850 CCGTGGGGCCTCTTATCAGCTGG No data
1180333612_1180333619 1 Left 1180333612 22:11555804-11555826 CCCGAGCTTCACCAGAACAACAT No data
Right 1180333619 22:11555828-11555850 CCGTGGGGCCTCTTATCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180333619 Original CRISPR CCGTGGGGCCTCTTATCAGC TGG Intergenic
No off target data available for this crispr