ID: 1180335537

View in Genome Browser
Species Human (GRCh38)
Location 22:11574119-11574141
Sequence CACTGTGTGCAGGTTGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180335537_1180335540 -6 Left 1180335537 22:11574119-11574141 CCTTGTGCAACCTGCACACAGTG No data
Right 1180335540 22:11574136-11574158 ACAGTGACCCGTAGTCTAGAGGG No data
1180335537_1180335539 -7 Left 1180335537 22:11574119-11574141 CCTTGTGCAACCTGCACACAGTG No data
Right 1180335539 22:11574135-11574157 CACAGTGACCCGTAGTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180335537 Original CRISPR CACTGTGTGCAGGTTGCACA AGG (reversed) Intergenic
No off target data available for this crispr