ID: 1180336917

View in Genome Browser
Species Human (GRCh38)
Location 22:11584992-11585014
Sequence TCCACATGGTCCTCAACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180336917_1180336921 21 Left 1180336917 22:11584992-11585014 CCAGCAGTTGAGGACCATGTGGA No data
Right 1180336921 22:11585036-11585058 TCCCAACCTGACAGCAGAACAGG No data
1180336917_1180336925 23 Left 1180336917 22:11584992-11585014 CCAGCAGTTGAGGACCATGTGGA No data
Right 1180336925 22:11585038-11585060 CCAACCTGACAGCAGAACAGGGG No data
1180336917_1180336923 22 Left 1180336917 22:11584992-11585014 CCAGCAGTTGAGGACCATGTGGA No data
Right 1180336923 22:11585037-11585059 CCCAACCTGACAGCAGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180336917 Original CRISPR TCCACATGGTCCTCAACTGC TGG (reversed) Intergenic
No off target data available for this crispr