ID: 1180339870

View in Genome Browser
Species Human (GRCh38)
Location 22:11609727-11609749
Sequence GGTTCCAGACAACCACAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180339870_1180339874 9 Left 1180339870 22:11609727-11609749 CCTTATTGTGGTTGTCTGGAACC No data
Right 1180339874 22:11609759-11609781 CTATCTCTGAGTATGCTTGTAGG No data
1180339870_1180339875 16 Left 1180339870 22:11609727-11609749 CCTTATTGTGGTTGTCTGGAACC No data
Right 1180339875 22:11609766-11609788 TGAGTATGCTTGTAGGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180339870 Original CRISPR GGTTCCAGACAACCACAATA AGG (reversed) Intergenic
No off target data available for this crispr