ID: 1180341001

View in Genome Browser
Species Human (GRCh38)
Location 22:11618510-11618532
Sequence ACGTGGGTAGTGGGGGGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180341001_1180341012 8 Left 1180341001 22:11618510-11618532 CCGGCTCCCCCCACTACCCACGT No data
Right 1180341012 22:11618541-11618563 CTTCATTTAGTGAGTCAGTTAGG No data
1180341001_1180341013 11 Left 1180341001 22:11618510-11618532 CCGGCTCCCCCCACTACCCACGT No data
Right 1180341013 22:11618544-11618566 CATTTAGTGAGTCAGTTAGGTGG No data
1180341001_1180341014 12 Left 1180341001 22:11618510-11618532 CCGGCTCCCCCCACTACCCACGT No data
Right 1180341014 22:11618545-11618567 ATTTAGTGAGTCAGTTAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180341001 Original CRISPR ACGTGGGTAGTGGGGGGAGC CGG (reversed) Intergenic
No off target data available for this crispr