ID: 1180342052

View in Genome Browser
Species Human (GRCh38)
Location 22:11627618-11627640
Sequence CTGAGGGAGCTCGTTGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 7, 1: 11, 2: 0, 3: 9, 4: 150}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180342039_1180342052 15 Left 1180342039 22:11627580-11627602 CCTCCTCCGGTCGCCGCCGCGGT No data
Right 1180342052 22:11627618-11627640 CTGAGGGAGCTCGTTGGTGTGGG 0: 7
1: 11
2: 0
3: 9
4: 150
1180342040_1180342052 12 Left 1180342040 22:11627583-11627605 CCTCCGGTCGCCGCCGCGGTGTC No data
Right 1180342052 22:11627618-11627640 CTGAGGGAGCTCGTTGGTGTGGG 0: 7
1: 11
2: 0
3: 9
4: 150
1180342032_1180342052 26 Left 1180342032 22:11627569-11627591 CCCCAGCGCCCCCTCCTCCGGTC 0: 6
1: 12
2: 4
3: 37
4: 436
Right 1180342052 22:11627618-11627640 CTGAGGGAGCTCGTTGGTGTGGG 0: 7
1: 11
2: 0
3: 9
4: 150
1180342043_1180342052 2 Left 1180342043 22:11627593-11627615 CCGCCGCGGTGTCCGCGAGTGGG No data
Right 1180342052 22:11627618-11627640 CTGAGGGAGCTCGTTGGTGTGGG 0: 7
1: 11
2: 0
3: 9
4: 150
1180342034_1180342052 24 Left 1180342034 22:11627571-11627593 CCAGCGCCCCCTCCTCCGGTCGC No data
Right 1180342052 22:11627618-11627640 CTGAGGGAGCTCGTTGGTGTGGG 0: 7
1: 11
2: 0
3: 9
4: 150
1180342031_1180342052 27 Left 1180342031 22:11627568-11627590 CCCCCAGCGCCCCCTCCTCCGGT 0: 4
1: 13
2: 3
3: 34
4: 470
Right 1180342052 22:11627618-11627640 CTGAGGGAGCTCGTTGGTGTGGG 0: 7
1: 11
2: 0
3: 9
4: 150
1180342045_1180342052 -1 Left 1180342045 22:11627596-11627618 CCGCGGTGTCCGCGAGTGGGTCC No data
Right 1180342052 22:11627618-11627640 CTGAGGGAGCTCGTTGGTGTGGG 0: 7
1: 11
2: 0
3: 9
4: 150
1180342037_1180342052 16 Left 1180342037 22:11627579-11627601 CCCTCCTCCGGTCGCCGCCGCGG No data
Right 1180342052 22:11627618-11627640 CTGAGGGAGCTCGTTGGTGTGGG 0: 7
1: 11
2: 0
3: 9
4: 150
1180342036_1180342052 17 Left 1180342036 22:11627578-11627600 CCCCTCCTCCGGTCGCCGCCGCG No data
Right 1180342052 22:11627618-11627640 CTGAGGGAGCTCGTTGGTGTGGG 0: 7
1: 11
2: 0
3: 9
4: 150
1180342033_1180342052 25 Left 1180342033 22:11627570-11627592 CCCAGCGCCCCCTCCTCCGGTCG No data
Right 1180342052 22:11627618-11627640 CTGAGGGAGCTCGTTGGTGTGGG 0: 7
1: 11
2: 0
3: 9
4: 150
1180342029_1180342052 30 Left 1180342029 22:11627565-11627587 CCACCCCCAGCGCCCCCTCCTCC 0: 5
1: 14
2: 26
3: 491
4: 4127
Right 1180342052 22:11627618-11627640 CTGAGGGAGCTCGTTGGTGTGGG 0: 7
1: 11
2: 0
3: 9
4: 150
1180342035_1180342052 18 Left 1180342035 22:11627577-11627599 CCCCCTCCTCCGGTCGCCGCCGC No data
Right 1180342052 22:11627618-11627640 CTGAGGGAGCTCGTTGGTGTGGG 0: 7
1: 11
2: 0
3: 9
4: 150
1180342041_1180342052 9 Left 1180342041 22:11627586-11627608 CCGGTCGCCGCCGCGGTGTCCGC No data
Right 1180342052 22:11627618-11627640 CTGAGGGAGCTCGTTGGTGTGGG 0: 7
1: 11
2: 0
3: 9
4: 150
1180342048_1180342052 -10 Left 1180342048 22:11627605-11627627 CCGCGAGTGGGTCCTGAGGGAGC No data
Right 1180342052 22:11627618-11627640 CTGAGGGAGCTCGTTGGTGTGGG 0: 7
1: 11
2: 0
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180342052 Original CRISPR CTGAGGGAGCTCGTTGGTGT GGG Intergenic
901633061 1:10657230-10657252 GAGAGTGAGCTCGTTGCTGTAGG - Intronic
904081220 1:27873584-27873606 ATGAGGGACCTCCTTGGTCTAGG - Intronic
907370872 1:54002647-54002669 CTGAGGGAGTTCCTGGATGTCGG - Intergenic
907614878 1:55913468-55913490 CTCAGGGAGCTCCTAGGTTTGGG - Intergenic
909726331 1:78840600-78840622 CTGTGGGAGCTCTTCGGGGTTGG - Intergenic
915321715 1:155060198-155060220 GTCAGGGAGCTGGTTGCTGTGGG - Exonic
918983599 1:191595568-191595590 CTCAGGGAGCTCCTAGGTCTGGG + Intergenic
920597559 1:207288056-207288078 CTGAGGCAGCTAGCTGGGGTAGG + Intergenic
921705909 1:218323122-218323144 CTCAGGGAGCTCCTAGGTCTGGG + Intronic
923025507 1:230200698-230200720 CTGAGGACTCTGGTTGGTGTGGG - Intronic
923915119 1:238492994-238493016 CTGAGGGAGTTCACAGGTGTGGG + Intergenic
1065201382 10:23316395-23316417 CTCAGGGAGCTCCTAGGTCTGGG + Intronic
1068213396 10:53952091-53952113 CTCAGGGAGCTCCTAGGTCTGGG + Intronic
1068300390 10:55131384-55131406 CTCAGGGAGCTCCTTGGTCTGGG + Intronic
1069751159 10:70745814-70745836 CTCTGGGAGCTGGTTGGTCTAGG + Intronic
1069879999 10:71586168-71586190 CTGAGGCAGCTCTGTGGGGTTGG + Intronic
1070096123 10:73339831-73339853 CTCAGGGAGCTCCTAGGTCTGGG + Intronic
1070330744 10:75415335-75415357 CCCAGGGAGCTGGCTGGTGTTGG + Intergenic
1070794712 10:79209952-79209974 CTGAGGGAGCCAGATGGTGCTGG - Intronic
1071849223 10:89551496-89551518 CTGATGGAGCACATTGTTGTTGG + Intronic
1073941769 10:108707480-108707502 CTGAGGTAGCTTATAGGTGTTGG + Intergenic
1075537970 10:123287128-123287150 CTGAGGGAGCAAGTTAGTGATGG + Intergenic
1076163411 10:128263349-128263371 CTGAGGGAGCTCCAAGGTGAGGG + Intergenic
1078010503 11:7569794-7569816 CTGAGGCAGCTCTTTTGTGATGG + Intronic
1078345468 11:10544215-10544237 CTCAGGGAGCTCTTAGGTCTGGG + Intergenic
1079997078 11:27305755-27305777 CTCAGGGAGCTCCTAGGTCTGGG - Intergenic
1081268674 11:41058170-41058192 CTGAGGGAGCTCCCAGGTCTGGG - Intronic
1081283937 11:41245601-41245623 CTCAGGGAGCTCCTAGGTCTGGG + Intronic
1082008486 11:47434711-47434733 CTGGGTGAGCTCATTGCTGTTGG + Intergenic
1082760453 11:57122031-57122053 ATAAGAGAGCTGGTTGGTGTTGG + Intergenic
1084560784 11:69904547-69904569 CTGTGGGAGCAGCTTGGTGTGGG - Intergenic
1085879477 11:80448916-80448938 CTGAGTGAGCTCTTGGGTGGAGG - Intergenic
1088354208 11:108925131-108925153 CTGAGGCAGATTGTTGGGGTGGG + Intronic
1088635317 11:111814414-111814436 CTGGGGGAGCTCCTGGGTGCTGG + Intronic
1089274841 11:117327893-117327915 CTGGGGGAGCGGGTGGGTGTTGG + Exonic
1094085105 12:26581856-26581878 ATGAGGGAGGTCGTTTGTTTTGG - Intronic
1101957250 12:109222553-109222575 CTGAGTGAGCTCGTTGAGGATGG - Exonic
1105267974 13:18838163-18838185 CTGAGGGGGCGCCTTGGGGTGGG - Intergenic
1105937934 13:25119102-25119124 CTGAGCGAGCTCGTGGGCGTCGG - Intergenic
1109396417 13:61765710-61765732 CTCAGGGAACTCGTAGGTCTGGG + Intergenic
1109982350 13:69924753-69924775 CTCAGGGAGCTCTTAGGTCTGGG - Intronic
1110201226 13:72852207-72852229 CTCAGGGAGCTCCTAGGTCTGGG - Intronic
1110705770 13:78601396-78601418 CTGAGGGGGCTGGGAGGTGTCGG - Exonic
1113994072 14:16052768-16052790 CTGAGGGAGCTCGTTGGTGTAGG + Intergenic
1114648870 14:24270793-24270815 CTAAGGGAGCTACTTGGGGTCGG + Intronic
1119261363 14:73239961-73239983 CTGAGGGAGCTCAGCGGTGCGGG - Intronic
1124715235 15:32053850-32053872 CTGCGTCAGCTCGTAGGTGTAGG + Intronic
1125862149 15:43009161-43009183 CTCAGGGAGCCCCTAGGTGTGGG - Intronic
1126431142 15:48586322-48586344 CTGATGGGGCTGGTTGGGGTGGG + Intronic
1131464459 15:92644482-92644504 CTGCCGGAGCTGGATGGTGTTGG - Intronic
1134031888 16:10998727-10998749 CTGAGTGAGCTCATGGCTGTAGG - Intronic
1134666681 16:16023888-16023910 TTGAGGGAGCTTGTGGGTGTTGG + Intronic
1135986872 16:27190347-27190369 CTGAGGGAGCCCCTAGGTCTGGG - Intergenic
1137621824 16:49881295-49881317 CTCCTGGAGCTCCTTGGTGTGGG + Intergenic
1137722455 16:50635364-50635386 CCAAGGGAGCTTGTTGATGTGGG + Exonic
1140470915 16:75213829-75213851 CTTAGGGAGCACGGTGGGGTTGG + Intergenic
1141174990 16:81712921-81712943 CAGAGGGAGCTGGATGGTGTGGG - Intergenic
1145216982 17:21060191-21060213 CTCAGGGAGCTCCTAGGTCTGGG + Intergenic
1149237626 17:54611636-54611658 CAGAGGGAGCACCCTGGTGTGGG + Intergenic
1152530545 17:80916222-80916244 CTCAGGGAGCTCCTAGGTCTGGG - Intronic
1153264212 18:3253270-3253292 CTGAGGGCGCTTCTTGGTCTTGG - Exonic
1157506746 18:48231778-48231800 CTCAGGGAGCTCCTTGGTCTGGG - Intronic
1157676081 18:49569562-49569584 CTGAGGGAGCCCTTTAGTGATGG - Intronic
1162741346 19:12775509-12775531 CTGCGGGCGCTCGCTGGTGGCGG - Exonic
1163588663 19:18177870-18177892 CTGAGGGAGCTGGTTGAGGAAGG - Exonic
1164466379 19:28490608-28490630 CTGTGGGGGCTGGATGGTGTGGG + Intergenic
1166229018 19:41414779-41414801 TCCAGGGAGCTTGTTGGTGTGGG + Intronic
1166939340 19:46353384-46353406 CTGAGGCAGCTGGGTGGAGTGGG - Intronic
1167418454 19:49389468-49389490 CTGAGGGACCCCGGGGGTGTTGG - Intronic
926554631 2:14342303-14342325 CTTGGGGAGCTCCTTGGTCTGGG - Intergenic
930056698 2:47257811-47257833 CTGAGAGAGGTCGTGGGGGTGGG + Intergenic
931300601 2:60974576-60974598 CTCAGGGAGCTCCTAGGTCTGGG - Intronic
932491923 2:72127907-72127929 CCGAGGGAGCCCCTTGGAGTGGG + Intergenic
933536576 2:83583090-83583112 CTGAGGCAGCTCCTGGGTGGGGG + Intergenic
937324577 2:120982867-120982889 CAGAGGTACCTCGTTGGAGTGGG - Exonic
938106863 2:128537512-128537534 CAGAGGGGGCTGGTTGCTGTTGG + Intergenic
938537590 2:132258102-132258124 CTGAGGGAGCTCGTTGGTGTGGG - Intergenic
938560795 2:132470415-132470437 CTGAGGGACCATGGTGGTGTTGG + Intronic
940565620 2:155356755-155356777 CTGAGTGGGCTCTCTGGTGTAGG - Intergenic
941432401 2:165427672-165427694 CTCAGGGAGCTCCTAGGTCTGGG - Intergenic
942584959 2:177465773-177465795 CTCAGGGAGCTCCTAGGTCTGGG + Intronic
943345554 2:186733888-186733910 CTCAGGGAGCTCCTAGGTCTGGG + Intronic
944869945 2:203899961-203899983 CTGAGTGAGCAGCTTGGTGTAGG - Intergenic
946495661 2:220192983-220193005 CTCAGGGAGCTCCTAGGTCTGGG - Intergenic
947054830 2:226088179-226088201 CTATGGGAGCTTCTTGGTGTGGG - Intergenic
947828447 2:233122350-233122372 CAGAGGGAGATTGTTGGCGTGGG + Intronic
1171567675 20:26209362-26209384 CTGAGGGAGCTCGTCGGTGTGGG - Intergenic
1171768353 20:29302043-29302065 CTGAGGGAGCTCGTTGGTGTGGG - Intergenic
1171811056 20:29744290-29744312 CTGAGGGAGCTCGTTGGTGTGGG - Intergenic
1171866502 20:30489885-30489907 CTGAGGGAGCTCGTTGGTGTGGG - Intergenic
1173207520 20:41006561-41006583 CTCAGGGAGCTCCTAGGTCTGGG + Intergenic
1175465673 20:59189912-59189934 CTTATGGAGCTCCTTGGTGATGG + Intergenic
1176547146 21:8206922-8206944 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
1176555051 21:8251131-8251153 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
1176566097 21:8389969-8389991 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
1176573973 21:8434155-8434177 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
1178467012 21:32858254-32858276 CTGAGGGAGCTCCCTGGTCTTGG + Intergenic
1179568410 21:42263427-42263449 GTGAGGGAGCTCCTAGGAGTGGG + Intronic
1180025932 21:45162150-45162172 CTCAGGGAGCTCCTAGGTCTGGG - Intronic
1180313196 22:11254747-11254769 CTGAGGGAGCTCGTTGGTGTAGG - Intergenic
1180342052 22:11627618-11627640 CTGAGGGAGCTCGTTGGTGTGGG + Intergenic
1181864907 22:25847292-25847314 AGGTGGGAGCTCCTTGGTGTGGG + Intronic
1203252021 22_KI270733v1_random:123207-123229 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
1203260075 22_KI270733v1_random:168290-168312 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
950207684 3:11093148-11093170 CTCAGGGAGCTCCTAGGTCTAGG - Intergenic
950437191 3:12987049-12987071 CTGAGGGAGCTCATCTGTGTGGG - Intronic
951718390 3:25673289-25673311 CTCAGGGAGCTCCTAGGTCTGGG + Intergenic
952793418 3:37218167-37218189 CTCAGGGAGCTCCTAGGTCTGGG - Intergenic
952960924 3:38588717-38588739 CTGAGGCACCTCGCTGGGGTTGG + Intronic
953150414 3:40319468-40319490 CTGAGGGAGATGGGTGGTGAGGG - Intergenic
953913261 3:46903451-46903473 CTGAGGGTGGCCGTTGGTGGTGG - Exonic
959389650 3:105758873-105758895 CTCAGGGAGCCTGTAGGTGTGGG + Intronic
960011056 3:112834970-112834992 CTCAGGGAGCTCCTAGGTCTGGG + Intronic
962285310 3:134080905-134080927 CTAAGGGTGCTCATTGCTGTTGG - Intronic
963065358 3:141259574-141259596 CAGATGGAGCTAGTCGGTGTAGG + Intronic
963503881 3:146161151-146161173 CTGAGTGAGGTCGTCGGTGGAGG + Exonic
968591070 4:1459928-1459950 CTGAGGGAGATCCTGGGTGTCGG + Intergenic
968672498 4:1859228-1859250 CTTAGGGACCTAGTTGGGGTTGG + Intergenic
968915636 4:3496005-3496027 CTGAGGGGCCTCGTGGGTGGGGG - Intronic
969673900 4:8604304-8604326 CTCAGGGAGCTGCTTGGTGCAGG + Intronic
970071450 4:12164223-12164245 CTGAGGAAGCTGGTTGAAGTTGG + Intergenic
971134753 4:23856134-23856156 CTGTGGGAGCTCTATGGGGTGGG - Intronic
973342249 4:49017251-49017273 CTGTGGCTGCTTGTTGGTGTGGG + Exonic
973398684 4:49619168-49619190 CTTAGGGAGCTCCTAGGTCTGGG - Intergenic
974420222 4:61663244-61663266 CTCAGGGAGCTCCTAGGTCTGGG - Intronic
974644138 4:64671098-64671120 CTTAGGGAGCTCCTAGGTCTGGG + Intergenic
975040798 4:69743027-69743049 CTCAGGGAGCTCCTAGGTTTGGG + Intronic
977645846 4:99410543-99410565 CTTAGGGAGCTCCTAGGTCTGGG + Intergenic
980306183 4:131064316-131064338 CTCAGGGAGCTCTTAGGTCTGGG + Intergenic
980729737 4:136811031-136811053 CTCAGGGAGCTCCCAGGTGTAGG + Intergenic
980985446 4:139690587-139690609 ATGTGGGAGCTCCTGGGTGTGGG + Intronic
982260308 4:153488617-153488639 CTGAGGGGGCTGGATGGAGTAGG + Intronic
982897447 4:160950585-160950607 CTGAGGCAGACCTTTGGTGTGGG - Intergenic
984102051 4:175498885-175498907 CTTAGGGAGCTCCCAGGTGTGGG + Intergenic
985680970 5:1255454-1255476 CAGACGGTGCTCGTGGGTGTGGG + Intronic
986309643 5:6542790-6542812 CTGAAGGAGCTCTGTGGGGTGGG - Intergenic
987951857 5:24686736-24686758 CTCAGGGAGCTCCTAGGTCTGGG + Intergenic
991359189 5:65802478-65802500 CTCAGGGAGCTCCTAGGTCTGGG + Intronic
993764860 5:91843836-91843858 CTGAGGGATCTCCTTGATTTTGG + Intergenic
994245313 5:97470594-97470616 CTCAGGGAGCTCCTAGGTCTAGG + Intergenic
997042721 5:130277381-130277403 CTTAGGGAGCTCCTAGGTCTGGG + Intergenic
999887082 5:155936105-155936127 CTCAGGGAGCTCCTAGGTCTGGG + Intronic
1002021724 5:176367888-176367910 GGGAGGGAGCTCCTTGGTGCAGG + Intronic
1004285170 6:14314897-14314919 CTGAGGGAGCACGGTGGAGAAGG - Intergenic
1005516041 6:26555263-26555285 CTCAGGCGGCTCGTTGGTCTAGG + Intergenic
1005775930 6:29130611-29130633 CTCAGGGAGCTCTTAGGTCTGGG - Intergenic
1005782018 6:29202115-29202137 CTCAGGGAGCTCCTAGGTCTGGG - Intergenic
1006776198 6:36594387-36594409 GTGAGAGAGTTGGTTGGTGTTGG + Exonic
1009241642 6:61192941-61192963 CTCAGGGAGCTCCTAGGTCTGGG + Intergenic
1010519773 6:76818460-76818482 CTCAGGGAGCTCCTAGGTCTGGG - Intergenic
1013177701 6:107691319-107691341 CTGTGGGAGCTCCTTGCTGTCGG - Intergenic
1014848938 6:126315987-126316009 TGGAGGGGGCTGGTTGGTGTAGG + Intergenic
1018898747 6:168040087-168040109 CTGATGGAGCTCGTTCATGGAGG + Exonic
1019525792 7:1479877-1479899 CTGGGGCAGCTCCTGGGTGTTGG - Intronic
1020761320 7:12270533-12270555 CTTAGGGAGCTCCTAGGTCTGGG - Intergenic
1024721845 7:52145650-52145672 CTGAGAGATGTTGTTGGTGTGGG - Intergenic
1026524644 7:71143544-71143566 GTGTGGGAGCTCCTTGGTGAAGG + Intronic
1028053010 7:86208161-86208183 CTTAGGGAGCTCCTAGGTCTGGG + Intergenic
1031061042 7:117051755-117051777 CTGATGGAGCTTGTTGGATTGGG + Intronic
1031786672 7:126041551-126041573 CTCAGGGAGCTCCTAGGTCTGGG - Intergenic
1031836960 7:126690530-126690552 CTCAGGGAGTTCCTTGGTCTGGG + Intronic
1033600771 7:142886955-142886977 ATGATGGAGCTCTTTGTTGTGGG - Intergenic
1036786523 8:11691693-11691715 TGGAGGGAGCTCCTTGGTCTGGG - Intronic
1040418659 8:47219188-47219210 CTGAGGCAGCTGGAAGGTGTTGG - Intergenic
1043568029 8:81570219-81570241 CTGAGGGAGCTCCCAGGTCTGGG + Intergenic
1043702776 8:83312344-83312366 CTCAGGGAGCTCATAGGTCTGGG + Intergenic
1044830696 8:96244917-96244939 CTGAAGGATCTGTTTGGTGTTGG - Intronic
1048794146 8:138133115-138133137 CTGAGGGTCCTCTCTGGTGTTGG - Intronic
1051877367 9:21806492-21806514 CTGAGGGGCCTCTTTGCTGTAGG + Intronic
1053445129 9:38146827-38146849 CTCAAGGAGCTCGTAGGTCTGGG - Intergenic
1056580298 9:87884917-87884939 CTGAGGAAGCTCGCTGGCGAAGG + Exonic
1056767057 9:89450905-89450927 CAGATGGAGCTGGTTGTTGTTGG - Intronic
1203468424 Un_GL000220v1:106357-106379 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
1203476245 Un_GL000220v1:150329-150351 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
1203361689 Un_KI270442v1:222207-222229 CTGAGGGAGCTCATTGGTGTGGG - Intergenic
1190789234 X:53683856-53683878 CTGAGGTAGCTCGCGGGTGGGGG - Exonic
1201076752 Y:10195349-10195371 CTAAGGGAGCTCGTTGGTGTGGG + Intergenic