ID: 1180342479

View in Genome Browser
Species Human (GRCh38)
Location 22:11629256-11629278
Sequence CACTCACGCGCGGCGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180342479_1180342496 26 Left 1180342479 22:11629256-11629278 CCCGCGCCCGCCGCGCGTGAGTG No data
Right 1180342496 22:11629305-11629327 CACGGGTCGGGCGTTCTGCCTGG No data
1180342479_1180342494 14 Left 1180342479 22:11629256-11629278 CCCGCGCCCGCCGCGCGTGAGTG No data
Right 1180342494 22:11629293-11629315 GCGGCTGCCATGCACGGGTCGGG No data
1180342479_1180342491 9 Left 1180342479 22:11629256-11629278 CCCGCGCCCGCCGCGCGTGAGTG No data
Right 1180342491 22:11629288-11629310 CCCTCGCGGCTGCCATGCACGGG No data
1180342479_1180342486 -5 Left 1180342479 22:11629256-11629278 CCCGCGCCCGCCGCGCGTGAGTG No data
Right 1180342486 22:11629274-11629296 GAGTGGCCGCCGGTCCCTCGCGG No data
1180342479_1180342489 8 Left 1180342479 22:11629256-11629278 CCCGCGCCCGCCGCGCGTGAGTG No data
Right 1180342489 22:11629287-11629309 TCCCTCGCGGCTGCCATGCACGG No data
1180342479_1180342493 13 Left 1180342479 22:11629256-11629278 CCCGCGCCCGCCGCGCGTGAGTG No data
Right 1180342493 22:11629292-11629314 CGCGGCTGCCATGCACGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180342479 Original CRISPR CACTCACGCGCGGCGGGCGC GGG (reversed) Intergenic