ID: 1180342738

View in Genome Browser
Species Human (GRCh38)
Location 22:11630668-11630690
Sequence TTTCTTGGAAGCTGCCCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180342738_1180342747 5 Left 1180342738 22:11630668-11630690 CCCGCTGGGCAGCTTCCAAGAAA No data
Right 1180342747 22:11630696-11630718 CTTTGGGTTTTTAGGTTCCGGGG No data
1180342738_1180342748 6 Left 1180342738 22:11630668-11630690 CCCGCTGGGCAGCTTCCAAGAAA No data
Right 1180342748 22:11630697-11630719 TTTGGGTTTTTAGGTTCCGGGGG No data
1180342738_1180342746 4 Left 1180342738 22:11630668-11630690 CCCGCTGGGCAGCTTCCAAGAAA No data
Right 1180342746 22:11630695-11630717 TCTTTGGGTTTTTAGGTTCCGGG No data
1180342738_1180342745 3 Left 1180342738 22:11630668-11630690 CCCGCTGGGCAGCTTCCAAGAAA No data
Right 1180342745 22:11630694-11630716 GTCTTTGGGTTTTTAGGTTCCGG No data
1180342738_1180342743 -3 Left 1180342738 22:11630668-11630690 CCCGCTGGGCAGCTTCCAAGAAA No data
Right 1180342743 22:11630688-11630710 AAACCAGTCTTTGGGTTTTTAGG No data
1180342738_1180342749 7 Left 1180342738 22:11630668-11630690 CCCGCTGGGCAGCTTCCAAGAAA No data
Right 1180342749 22:11630698-11630720 TTGGGTTTTTAGGTTCCGGGGGG No data
1180342738_1180342750 14 Left 1180342738 22:11630668-11630690 CCCGCTGGGCAGCTTCCAAGAAA No data
Right 1180342750 22:11630705-11630727 TTTAGGTTCCGGGGGGAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180342738 Original CRISPR TTTCTTGGAAGCTGCCCAGC GGG (reversed) Intergenic
No off target data available for this crispr