ID: 1180344718

View in Genome Browser
Species Human (GRCh38)
Location 22:11697616-11697638
Sequence GCAGCTCCTCACCAGAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180344718_1180344726 2 Left 1180344718 22:11697616-11697638 CCACATCTCTGGTGAGGAGCTGC No data
Right 1180344726 22:11697641-11697663 CTTGGGTCTGAGTTTCTGGGAGG No data
1180344718_1180344732 20 Left 1180344718 22:11697616-11697638 CCACATCTCTGGTGAGGAGCTGC No data
Right 1180344732 22:11697659-11697681 GGAGGGGAGAGGGAGAAGCTGGG No data
1180344718_1180344721 -2 Left 1180344718 22:11697616-11697638 CCACATCTCTGGTGAGGAGCTGC No data
Right 1180344721 22:11697637-11697659 GCCCCTTGGGTCTGAGTTTCTGG No data
1180344718_1180344734 29 Left 1180344718 22:11697616-11697638 CCACATCTCTGGTGAGGAGCTGC No data
Right 1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG No data
1180344718_1180344731 19 Left 1180344718 22:11697616-11697638 CCACATCTCTGGTGAGGAGCTGC No data
Right 1180344731 22:11697658-11697680 GGGAGGGGAGAGGGAGAAGCTGG No data
1180344718_1180344727 3 Left 1180344718 22:11697616-11697638 CCACATCTCTGGTGAGGAGCTGC No data
Right 1180344727 22:11697642-11697664 TTGGGTCTGAGTTTCTGGGAGGG No data
1180344718_1180344729 9 Left 1180344718 22:11697616-11697638 CCACATCTCTGGTGAGGAGCTGC No data
Right 1180344729 22:11697648-11697670 CTGAGTTTCTGGGAGGGGAGAGG No data
1180344718_1180344730 10 Left 1180344718 22:11697616-11697638 CCACATCTCTGGTGAGGAGCTGC No data
Right 1180344730 22:11697649-11697671 TGAGTTTCTGGGAGGGGAGAGGG No data
1180344718_1180344728 4 Left 1180344718 22:11697616-11697638 CCACATCTCTGGTGAGGAGCTGC No data
Right 1180344728 22:11697643-11697665 TGGGTCTGAGTTTCTGGGAGGGG No data
1180344718_1180344733 25 Left 1180344718 22:11697616-11697638 CCACATCTCTGGTGAGGAGCTGC No data
Right 1180344733 22:11697664-11697686 GGAGAGGGAGAAGCTGGGTGAGG No data
1180344718_1180344723 -1 Left 1180344718 22:11697616-11697638 CCACATCTCTGGTGAGGAGCTGC No data
Right 1180344723 22:11697638-11697660 CCCCTTGGGTCTGAGTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180344718 Original CRISPR GCAGCTCCTCACCAGAGATG TGG (reversed) Intergenic
No off target data available for this crispr