ID: 1180344724

View in Genome Browser
Species Human (GRCh38)
Location 22:11697639-11697661
Sequence TCCCAGAAACTCAGACCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180344724_1180344731 -4 Left 1180344724 22:11697639-11697661 CCCTTGGGTCTGAGTTTCTGGGA No data
Right 1180344731 22:11697658-11697680 GGGAGGGGAGAGGGAGAAGCTGG No data
1180344724_1180344735 20 Left 1180344724 22:11697639-11697661 CCCTTGGGTCTGAGTTTCTGGGA No data
Right 1180344735 22:11697682-11697704 TGAGGCAGGCATGAATCTTGAGG No data
1180344724_1180344734 6 Left 1180344724 22:11697639-11697661 CCCTTGGGTCTGAGTTTCTGGGA No data
Right 1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG No data
1180344724_1180344733 2 Left 1180344724 22:11697639-11697661 CCCTTGGGTCTGAGTTTCTGGGA No data
Right 1180344733 22:11697664-11697686 GGAGAGGGAGAAGCTGGGTGAGG No data
1180344724_1180344737 28 Left 1180344724 22:11697639-11697661 CCCTTGGGTCTGAGTTTCTGGGA No data
Right 1180344737 22:11697690-11697712 GCATGAATCTTGAGGAGTCAGGG No data
1180344724_1180344736 27 Left 1180344724 22:11697639-11697661 CCCTTGGGTCTGAGTTTCTGGGA No data
Right 1180344736 22:11697689-11697711 GGCATGAATCTTGAGGAGTCAGG No data
1180344724_1180344732 -3 Left 1180344724 22:11697639-11697661 CCCTTGGGTCTGAGTTTCTGGGA No data
Right 1180344732 22:11697659-11697681 GGAGGGGAGAGGGAGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180344724 Original CRISPR TCCCAGAAACTCAGACCCAA GGG (reversed) Intergenic
No off target data available for this crispr