ID: 1180344734

View in Genome Browser
Species Human (GRCh38)
Location 22:11697668-11697690
Sequence AGGGAGAAGCTGGGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180344722_1180344734 7 Left 1180344722 22:11697638-11697660 CCCCTTGGGTCTGAGTTTCTGGG No data
Right 1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG No data
1180344725_1180344734 5 Left 1180344725 22:11697640-11697662 CCTTGGGTCTGAGTTTCTGGGAG No data
Right 1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG No data
1180344724_1180344734 6 Left 1180344724 22:11697639-11697661 CCCTTGGGTCTGAGTTTCTGGGA No data
Right 1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG No data
1180344718_1180344734 29 Left 1180344718 22:11697616-11697638 CCACATCTCTGGTGAGGAGCTGC No data
Right 1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180344734 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG Intergenic
No off target data available for this crispr