ID: 1180345214

View in Genome Browser
Species Human (GRCh38)
Location 22:11700941-11700963
Sequence AGGGAGAAGCTGGGTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180345214_1180345226 7 Left 1180345214 22:11700941-11700963 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1180345226 22:11700971-11700993 CCCAGAAACTCAGACCCAAGGGG No data
1180345214_1180345224 6 Left 1180345214 22:11700941-11700963 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1180345224 22:11700970-11700992 TCCCAGAAACTCAGACCCAAGGG No data
1180345214_1180345230 29 Left 1180345214 22:11700941-11700963 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1180345230 22:11700993-11701015 GCAGCTCCTCACCAGAGATGTGG No data
1180345214_1180345223 5 Left 1180345214 22:11700941-11700963 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1180345223 22:11700969-11700991 CTCCCAGAAACTCAGACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180345214 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr