ID: 1180345598

View in Genome Browser
Species Human (GRCh38)
Location 22:11703065-11703087
Sequence GTGTGACAGTAGCAAGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180345598_1180345601 7 Left 1180345598 22:11703065-11703087 CCATCTACTTGCTACTGTCACAC No data
Right 1180345601 22:11703095-11703117 AGCAGAAGAGGCCCCTGTAATGG No data
1180345598_1180345599 -5 Left 1180345598 22:11703065-11703087 CCATCTACTTGCTACTGTCACAC No data
Right 1180345599 22:11703083-11703105 CACACTCTTGCCAGCAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180345598 Original CRISPR GTGTGACAGTAGCAAGTAGA TGG (reversed) Intergenic
No off target data available for this crispr