ID: 1180346257

View in Genome Browser
Species Human (GRCh38)
Location 22:11706228-11706250
Sequence CAGTCCCTGCACTGGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180346257_1180346265 11 Left 1180346257 22:11706228-11706250 CCTGGGTCCCAGTGCAGGGACTG No data
Right 1180346265 22:11706262-11706284 CTTTCGTCTGTGGGGCACCCAGG No data
1180346257_1180346262 1 Left 1180346257 22:11706228-11706250 CCTGGGTCCCAGTGCAGGGACTG No data
Right 1180346262 22:11706252-11706274 TGGGAAGACACTTTCGTCTGTGG No data
1180346257_1180346264 3 Left 1180346257 22:11706228-11706250 CCTGGGTCCCAGTGCAGGGACTG No data
Right 1180346264 22:11706254-11706276 GGAAGACACTTTCGTCTGTGGGG No data
1180346257_1180346263 2 Left 1180346257 22:11706228-11706250 CCTGGGTCCCAGTGCAGGGACTG No data
Right 1180346263 22:11706253-11706275 GGGAAGACACTTTCGTCTGTGGG No data
1180346257_1180346266 27 Left 1180346257 22:11706228-11706250 CCTGGGTCCCAGTGCAGGGACTG No data
Right 1180346266 22:11706278-11706300 ACCCAGGCCGTGCTTCTCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180346257 Original CRISPR CAGTCCCTGCACTGGGACCC AGG (reversed) Intergenic
No off target data available for this crispr