ID: 1180348877

View in Genome Browser
Species Human (GRCh38)
Location 22:11781203-11781225
Sequence AATCACCTGGGGCAGTGATG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180348870_1180348877 18 Left 1180348870 22:11781162-11781184 CCAGCAGCTGCCAGTAGTTCTCA No data
Right 1180348877 22:11781203-11781225 AATCACCTGGGGCAGTGATGCGG No data
1180348872_1180348877 8 Left 1180348872 22:11781172-11781194 CCAGTAGTTCTCACACTTTGGCT No data
Right 1180348877 22:11781203-11781225 AATCACCTGGGGCAGTGATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180348877 Original CRISPR AATCACCTGGGGCAGTGATG CGG Intergenic
No off target data available for this crispr