ID: 1180352557

View in Genome Browser
Species Human (GRCh38)
Location 22:11816662-11816684
Sequence AGGGAGAAGCTGGGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180352540_1180352557 23 Left 1180352540 22:11816616-11816638 CCCTGGTGAGGAGCTGCCCCTTG No data
Right 1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG No data
1180352547_1180352557 6 Left 1180352547 22:11816633-11816655 CCCTTGGGTCTGAGTTTCTGGGA No data
Right 1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG No data
1180352545_1180352557 7 Left 1180352545 22:11816632-11816654 CCCCTTGGGTCTGAGTTTCTGGG No data
Right 1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG No data
1180352541_1180352557 22 Left 1180352541 22:11816617-11816639 CCTGGTGAGGAGCTGCCCCTTGG No data
Right 1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG No data
1180352539_1180352557 29 Left 1180352539 22:11816610-11816632 CCACATCCCTGGTGAGGAGCTGC No data
Right 1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG No data
1180352548_1180352557 5 Left 1180352548 22:11816634-11816656 CCTTGGGTCTGAGTTTCTGGGAG No data
Right 1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180352557 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG Intergenic
No off target data available for this crispr