ID: 1180352977 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:11819099-11819121 |
| Sequence | CTGGGGGACCCCTGGGTGCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1180352977_1180352987 | 8 | Left | 1180352977 | 22:11819099-11819121 | CCATGCACCCAGGGGTCCCCCAG | No data | ||
| Right | 1180352987 | 22:11819130-11819152 | AGGTTTCGGGAGAATATGAGCGG | No data | ||||
| 1180352977_1180352983 | -6 | Left | 1180352977 | 22:11819099-11819121 | CCATGCACCCAGGGGTCCCCCAG | No data | ||
| Right | 1180352983 | 22:11819116-11819138 | CCCCAGAGACTCACAGGTTTCGG | No data | ||||
| 1180352977_1180352985 | -5 | Left | 1180352977 | 22:11819099-11819121 | CCATGCACCCAGGGGTCCCCCAG | No data | ||
| Right | 1180352985 | 22:11819117-11819139 | CCCAGAGACTCACAGGTTTCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1180352977 | Original CRISPR | CTGGGGGACCCCTGGGTGCA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||