ID: 1180352977

View in Genome Browser
Species Human (GRCh38)
Location 22:11819099-11819121
Sequence CTGGGGGACCCCTGGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180352977_1180352987 8 Left 1180352977 22:11819099-11819121 CCATGCACCCAGGGGTCCCCCAG No data
Right 1180352987 22:11819130-11819152 AGGTTTCGGGAGAATATGAGCGG No data
1180352977_1180352983 -6 Left 1180352977 22:11819099-11819121 CCATGCACCCAGGGGTCCCCCAG No data
Right 1180352983 22:11819116-11819138 CCCCAGAGACTCACAGGTTTCGG No data
1180352977_1180352985 -5 Left 1180352977 22:11819099-11819121 CCATGCACCCAGGGGTCCCCCAG No data
Right 1180352985 22:11819117-11819139 CCCAGAGACTCACAGGTTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180352977 Original CRISPR CTGGGGGACCCCTGGGTGCA TGG (reversed) Intergenic
No off target data available for this crispr