ID: 1180352994

View in Genome Browser
Species Human (GRCh38)
Location 22:11819182-11819204
Sequence AGGGAGAAGCTGGGTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180352994_1180353011 23 Left 1180352994 22:11819182-11819204 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1180353011 22:11819228-11819250 CAAGGGGCAGCTCCTCACCAGGG No data
1180352994_1180353010 22 Left 1180352994 22:11819182-11819204 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1180353010 22:11819227-11819249 CCAAGGGGCAGCTCCTCACCAGG No data
1180352994_1180353012 29 Left 1180352994 22:11819182-11819204 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1180353012 22:11819234-11819256 GCAGCTCCTCACCAGGGATGTGG No data
1180352994_1180353006 7 Left 1180352994 22:11819182-11819204 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1180353006 22:11819212-11819234 CCCAGAAACTCAGACCCAAGGGG No data
1180352994_1180353003 5 Left 1180352994 22:11819182-11819204 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1180353003 22:11819210-11819232 CTCCCAGAAACTCAGACCCAAGG No data
1180352994_1180353004 6 Left 1180352994 22:11819182-11819204 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1180353004 22:11819211-11819233 TCCCAGAAACTCAGACCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180352994 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr