ID: 1180353003

View in Genome Browser
Species Human (GRCh38)
Location 22:11819210-11819232
Sequence CTCCCAGAAACTCAGACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180352996_1180353003 -4 Left 1180352996 22:11819191-11819213 CCCAGCTTCTCCCTCTCCCCTCC No data
Right 1180353003 22:11819210-11819232 CTCCCAGAAACTCAGACCCAAGG No data
1180352995_1180353003 1 Left 1180352995 22:11819186-11819208 CCTCACCCAGCTTCTCCCTCTCC No data
Right 1180353003 22:11819210-11819232 CTCCCAGAAACTCAGACCCAAGG No data
1180352992_1180353003 26 Left 1180352992 22:11819161-11819183 CCTGACTCCTCAAGATTCATGCC No data
Right 1180353003 22:11819210-11819232 CTCCCAGAAACTCAGACCCAAGG No data
1180352991_1180353003 27 Left 1180352991 22:11819160-11819182 CCCTGACTCCTCAAGATTCATGC No data
Right 1180353003 22:11819210-11819232 CTCCCAGAAACTCAGACCCAAGG No data
1180352997_1180353003 -5 Left 1180352997 22:11819192-11819214 CCAGCTTCTCCCTCTCCCCTCCC No data
Right 1180353003 22:11819210-11819232 CTCCCAGAAACTCAGACCCAAGG No data
1180352994_1180353003 5 Left 1180352994 22:11819182-11819204 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1180353003 22:11819210-11819232 CTCCCAGAAACTCAGACCCAAGG No data
1180352993_1180353003 19 Left 1180352993 22:11819168-11819190 CCTCAAGATTCATGCCTGCCTCA No data
Right 1180353003 22:11819210-11819232 CTCCCAGAAACTCAGACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180353003 Original CRISPR CTCCCAGAAACTCAGACCCA AGG Intergenic
No off target data available for this crispr