ID: 1180353010

View in Genome Browser
Species Human (GRCh38)
Location 22:11819227-11819249
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180353007_1180353010 -9 Left 1180353007 22:11819213-11819235 CCAGAAACTCAGACCCAAGGGGC No data
Right 1180353010 22:11819227-11819249 CCAAGGGGCAGCTCCTCACCAGG No data
1180352999_1180353010 2 Left 1180352999 22:11819202-11819224 CCTCTCCCCTCCCAGAAACTCAG No data
Right 1180353010 22:11819227-11819249 CCAAGGGGCAGCTCCTCACCAGG No data
1180352995_1180353010 18 Left 1180352995 22:11819186-11819208 CCTCACCCAGCTTCTCCCTCTCC No data
Right 1180353010 22:11819227-11819249 CCAAGGGGCAGCTCCTCACCAGG No data
1180352998_1180353010 3 Left 1180352998 22:11819201-11819223 CCCTCTCCCCTCCCAGAAACTCA No data
Right 1180353010 22:11819227-11819249 CCAAGGGGCAGCTCCTCACCAGG No data
1180353001_1180353010 -4 Left 1180353001 22:11819208-11819230 CCCTCCCAGAAACTCAGACCCAA No data
Right 1180353010 22:11819227-11819249 CCAAGGGGCAGCTCCTCACCAGG No data
1180352996_1180353010 13 Left 1180352996 22:11819191-11819213 CCCAGCTTCTCCCTCTCCCCTCC No data
Right 1180353010 22:11819227-11819249 CCAAGGGGCAGCTCCTCACCAGG No data
1180352997_1180353010 12 Left 1180352997 22:11819192-11819214 CCAGCTTCTCCCTCTCCCCTCCC No data
Right 1180353010 22:11819227-11819249 CCAAGGGGCAGCTCCTCACCAGG No data
1180353002_1180353010 -5 Left 1180353002 22:11819209-11819231 CCTCCCAGAAACTCAGACCCAAG No data
Right 1180353010 22:11819227-11819249 CCAAGGGGCAGCTCCTCACCAGG No data
1180352994_1180353010 22 Left 1180352994 22:11819182-11819204 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1180353010 22:11819227-11819249 CCAAGGGGCAGCTCCTCACCAGG No data
1180353005_1180353010 -8 Left 1180353005 22:11819212-11819234 CCCAGAAACTCAGACCCAAGGGG No data
Right 1180353010 22:11819227-11819249 CCAAGGGGCAGCTCCTCACCAGG No data
1180353000_1180353010 -3 Left 1180353000 22:11819207-11819229 CCCCTCCCAGAAACTCAGACCCA No data
Right 1180353010 22:11819227-11819249 CCAAGGGGCAGCTCCTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180353010 Original CRISPR CCAAGGGGCAGCTCCTCACC AGG Intergenic
No off target data available for this crispr