ID: 1180353365

View in Genome Browser
Species Human (GRCh38)
Location 22:11821306-11821328
Sequence GTGTGACAGTAGCAAGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180353365_1180353368 8 Left 1180353365 22:11821306-11821328 CCATCTACTTGCTACTGTCACAC No data
Right 1180353368 22:11821337-11821359 GCAGAAAAGGCCCCTTGTAATGG No data
1180353365_1180353366 -5 Left 1180353365 22:11821306-11821328 CCATCTACTTGCTACTGTCACAC No data
Right 1180353366 22:11821324-11821346 CACACTCTTGCCAGCAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180353365 Original CRISPR GTGTGACAGTAGCAAGTAGA TGG (reversed) Intergenic
No off target data available for this crispr