ID: 1180353365 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:11821306-11821328 |
| Sequence | GTGTGACAGTAGCAAGTAGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1180353365_1180353368 | 8 | Left | 1180353365 | 22:11821306-11821328 | CCATCTACTTGCTACTGTCACAC | No data | ||
| Right | 1180353368 | 22:11821337-11821359 | GCAGAAAAGGCCCCTTGTAATGG | No data | ||||
| 1180353365_1180353366 | -5 | Left | 1180353365 | 22:11821306-11821328 | CCATCTACTTGCTACTGTCACAC | No data | ||
| Right | 1180353366 | 22:11821324-11821346 | CACACTCTTGCCAGCAGAAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1180353365 | Original CRISPR | GTGTGACAGTAGCAAGTAGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||