ID: 1180364359

View in Genome Browser
Species Human (GRCh38)
Location 22:11925608-11925630
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180364359_1180364365 -2 Left 1180364359 22:11925608-11925630 CCCCTGACCCTGTTGCACATCAC No data
Right 1180364365 22:11925629-11925651 ACTGTACAGGACCTCCCAAATGG No data
1180364359_1180364373 30 Left 1180364359 22:11925608-11925630 CCCCTGACCCTGTTGCACATCAC No data
Right 1180364373 22:11925661-11925683 CTACCACCACCAGCATTCCTTGG No data
1180364359_1180364367 0 Left 1180364359 22:11925608-11925630 CCCCTGACCCTGTTGCACATCAC No data
Right 1180364367 22:11925631-11925653 TGTACAGGACCTCCCAAATGGGG No data
1180364359_1180364366 -1 Left 1180364359 22:11925608-11925630 CCCCTGACCCTGTTGCACATCAC No data
Right 1180364366 22:11925630-11925652 CTGTACAGGACCTCCCAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180364359 Original CRISPR GTGATGTGCAACAGGGTCAG GGG (reversed) Intergenic
No off target data available for this crispr