ID: 1180364363

View in Genome Browser
Species Human (GRCh38)
Location 22:11925616-11925638
Sequence CCTGTACAGTGATGTGCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180364363_1180364367 -8 Left 1180364363 22:11925616-11925638 CCTGTTGCACATCACTGTACAGG No data
Right 1180364367 22:11925631-11925653 TGTACAGGACCTCCCAAATGGGG No data
1180364363_1180364366 -9 Left 1180364363 22:11925616-11925638 CCTGTTGCACATCACTGTACAGG No data
Right 1180364366 22:11925630-11925652 CTGTACAGGACCTCCCAAATGGG No data
1180364363_1180364365 -10 Left 1180364363 22:11925616-11925638 CCTGTTGCACATCACTGTACAGG No data
Right 1180364365 22:11925629-11925651 ACTGTACAGGACCTCCCAAATGG No data
1180364363_1180364373 22 Left 1180364363 22:11925616-11925638 CCTGTTGCACATCACTGTACAGG No data
Right 1180364373 22:11925661-11925683 CTACCACCACCAGCATTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180364363 Original CRISPR CCTGTACAGTGATGTGCAAC AGG (reversed) Intergenic
No off target data available for this crispr