ID: 1180364367

View in Genome Browser
Species Human (GRCh38)
Location 22:11925631-11925653
Sequence TGTACAGGACCTCCCAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180364363_1180364367 -8 Left 1180364363 22:11925616-11925638 CCTGTTGCACATCACTGTACAGG No data
Right 1180364367 22:11925631-11925653 TGTACAGGACCTCCCAAATGGGG No data
1180364362_1180364367 -7 Left 1180364362 22:11925615-11925637 CCCTGTTGCACATCACTGTACAG No data
Right 1180364367 22:11925631-11925653 TGTACAGGACCTCCCAAATGGGG No data
1180364360_1180364367 -1 Left 1180364360 22:11925609-11925631 CCCTGACCCTGTTGCACATCACT No data
Right 1180364367 22:11925631-11925653 TGTACAGGACCTCCCAAATGGGG No data
1180364361_1180364367 -2 Left 1180364361 22:11925610-11925632 CCTGACCCTGTTGCACATCACTG No data
Right 1180364367 22:11925631-11925653 TGTACAGGACCTCCCAAATGGGG No data
1180364358_1180364367 22 Left 1180364358 22:11925586-11925608 CCAGAATGGTTCTGTAAGCAGGC No data
Right 1180364367 22:11925631-11925653 TGTACAGGACCTCCCAAATGGGG No data
1180364359_1180364367 0 Left 1180364359 22:11925608-11925630 CCCCTGACCCTGTTGCACATCAC No data
Right 1180364367 22:11925631-11925653 TGTACAGGACCTCCCAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180364367 Original CRISPR TGTACAGGACCTCCCAAATG GGG Intergenic
No off target data available for this crispr