ID: 1180364373

View in Genome Browser
Species Human (GRCh38)
Location 22:11925661-11925683
Sequence CTACCACCACCAGCATTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180364368_1180364373 -2 Left 1180364368 22:11925640-11925662 CCTCCCAAATGGGGCCTCCAGCT No data
Right 1180364373 22:11925661-11925683 CTACCACCACCAGCATTCCTTGG No data
1180364360_1180364373 29 Left 1180364360 22:11925609-11925631 CCCTGACCCTGTTGCACATCACT No data
Right 1180364373 22:11925661-11925683 CTACCACCACCAGCATTCCTTGG No data
1180364359_1180364373 30 Left 1180364359 22:11925608-11925630 CCCCTGACCCTGTTGCACATCAC No data
Right 1180364373 22:11925661-11925683 CTACCACCACCAGCATTCCTTGG No data
1180364369_1180364373 -5 Left 1180364369 22:11925643-11925665 CCCAAATGGGGCCTCCAGCTACC No data
Right 1180364373 22:11925661-11925683 CTACCACCACCAGCATTCCTTGG No data
1180364361_1180364373 28 Left 1180364361 22:11925610-11925632 CCTGACCCTGTTGCACATCACTG No data
Right 1180364373 22:11925661-11925683 CTACCACCACCAGCATTCCTTGG No data
1180364363_1180364373 22 Left 1180364363 22:11925616-11925638 CCTGTTGCACATCACTGTACAGG No data
Right 1180364373 22:11925661-11925683 CTACCACCACCAGCATTCCTTGG No data
1180364370_1180364373 -6 Left 1180364370 22:11925644-11925666 CCAAATGGGGCCTCCAGCTACCA No data
Right 1180364373 22:11925661-11925683 CTACCACCACCAGCATTCCTTGG No data
1180364362_1180364373 23 Left 1180364362 22:11925615-11925637 CCCTGTTGCACATCACTGTACAG No data
Right 1180364373 22:11925661-11925683 CTACCACCACCAGCATTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180364373 Original CRISPR CTACCACCACCAGCATTCCT TGG Intergenic
No off target data available for this crispr