ID: 1180367879

View in Genome Browser
Species Human (GRCh38)
Location 22:11957143-11957165
Sequence TGCCCTGAGCTTGCACAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180367879_1180367888 25 Left 1180367879 22:11957143-11957165 CCAGTTTGTGCAAGCTCAGGGCA No data
Right 1180367888 22:11957191-11957213 CCTCGGCCCCCTCTACACTTTGG No data
1180367879_1180367889 26 Left 1180367879 22:11957143-11957165 CCAGTTTGTGCAAGCTCAGGGCA No data
Right 1180367889 22:11957192-11957214 CTCGGCCCCCTCTACACTTTGGG No data
1180367879_1180367880 8 Left 1180367879 22:11957143-11957165 CCAGTTTGTGCAAGCTCAGGGCA No data
Right 1180367880 22:11957174-11957196 ATGCCAGCCCCCTGCCACCTCGG 0: 24
1: 34
2: 93
3: 131
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180367879 Original CRISPR TGCCCTGAGCTTGCACAAAC TGG (reversed) Intergenic
No off target data available for this crispr