ID: 1180367881

View in Genome Browser
Species Human (GRCh38)
Location 22:11957177-11957199
Sequence GGGCCGAGGTGGCAGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180367881_1180367895 12 Left 1180367881 22:11957177-11957199 CCAGCCCCCTGCCACCTCGGCCC No data
Right 1180367895 22:11957212-11957234 GGGAACTGATGAGCACAGTAGGG No data
1180367881_1180367896 21 Left 1180367881 22:11957177-11957199 CCAGCCCCCTGCCACCTCGGCCC No data
Right 1180367896 22:11957221-11957243 TGAGCACAGTAGGGACGTTGAGG No data
1180367881_1180367897 24 Left 1180367881 22:11957177-11957199 CCAGCCCCCTGCCACCTCGGCCC No data
Right 1180367897 22:11957224-11957246 GCACAGTAGGGACGTTGAGGTGG No data
1180367881_1180367898 25 Left 1180367881 22:11957177-11957199 CCAGCCCCCTGCCACCTCGGCCC No data
Right 1180367898 22:11957225-11957247 CACAGTAGGGACGTTGAGGTGGG No data
1180367881_1180367888 -9 Left 1180367881 22:11957177-11957199 CCAGCCCCCTGCCACCTCGGCCC No data
Right 1180367888 22:11957191-11957213 CCTCGGCCCCCTCTACACTTTGG No data
1180367881_1180367889 -8 Left 1180367881 22:11957177-11957199 CCAGCCCCCTGCCACCTCGGCCC No data
Right 1180367889 22:11957192-11957214 CTCGGCCCCCTCTACACTTTGGG No data
1180367881_1180367894 11 Left 1180367881 22:11957177-11957199 CCAGCCCCCTGCCACCTCGGCCC No data
Right 1180367894 22:11957211-11957233 TGGGAACTGATGAGCACAGTAGG No data
1180367881_1180367899 26 Left 1180367881 22:11957177-11957199 CCAGCCCCCTGCCACCTCGGCCC No data
Right 1180367899 22:11957226-11957248 ACAGTAGGGACGTTGAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180367881 Original CRISPR GGGCCGAGGTGGCAGGGGGC TGG (reversed) Intergenic
No off target data available for this crispr