ID: 1180367889

View in Genome Browser
Species Human (GRCh38)
Location 22:11957192-11957214
Sequence CTCGGCCCCCTCTACACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180367879_1180367889 26 Left 1180367879 22:11957143-11957165 CCAGTTTGTGCAAGCTCAGGGCA No data
Right 1180367889 22:11957192-11957214 CTCGGCCCCCTCTACACTTTGGG No data
1180367881_1180367889 -8 Left 1180367881 22:11957177-11957199 CCAGCCCCCTGCCACCTCGGCCC No data
Right 1180367889 22:11957192-11957214 CTCGGCCCCCTCTACACTTTGGG No data
1180367878_1180367889 27 Left 1180367878 22:11957142-11957164 CCCAGTTTGTGCAAGCTCAGGGC No data
Right 1180367889 22:11957192-11957214 CTCGGCCCCCTCTACACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180367889 Original CRISPR CTCGGCCCCCTCTACACTTT GGG Intergenic
No off target data available for this crispr