ID: 1180380304

View in Genome Browser
Species Human (GRCh38)
Location 22:12134095-12134117
Sequence GTGTACACCCCCTGCCATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180380304_1180380310 17 Left 1180380304 22:12134095-12134117 CCAATATGGCAGGGGGTGTACAC No data
Right 1180380310 22:12134135-12134157 TCCTATATCCACGGGGGAAAAGG No data
1180380304_1180380307 9 Left 1180380304 22:12134095-12134117 CCAATATGGCAGGGGGTGTACAC No data
Right 1180380307 22:12134127-12134149 GATACTGTTCCTATATCCACGGG No data
1180380304_1180380308 10 Left 1180380304 22:12134095-12134117 CCAATATGGCAGGGGGTGTACAC No data
Right 1180380308 22:12134128-12134150 ATACTGTTCCTATATCCACGGGG No data
1180380304_1180380314 25 Left 1180380304 22:12134095-12134117 CCAATATGGCAGGGGGTGTACAC No data
Right 1180380314 22:12134143-12134165 CCACGGGGGAAAAGGATATTGGG No data
1180380304_1180380306 8 Left 1180380304 22:12134095-12134117 CCAATATGGCAGGGGGTGTACAC No data
Right 1180380306 22:12134126-12134148 CGATACTGTTCCTATATCCACGG No data
1180380304_1180380309 11 Left 1180380304 22:12134095-12134117 CCAATATGGCAGGGGGTGTACAC No data
Right 1180380309 22:12134129-12134151 TACTGTTCCTATATCCACGGGGG No data
1180380304_1180380312 24 Left 1180380304 22:12134095-12134117 CCAATATGGCAGGGGGTGTACAC No data
Right 1180380312 22:12134142-12134164 TCCACGGGGGAAAAGGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180380304 Original CRISPR GTGTACACCCCCTGCCATAT TGG (reversed) Intergenic
No off target data available for this crispr