ID: 1180381277

View in Genome Browser
Species Human (GRCh38)
Location 22:12141160-12141182
Sequence GTGTACACCCACTGCGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180381277_1180381283 16 Left 1180381277 22:12141160-12141182 CCAATATCGCAGTGGGTGTACAC No data
Right 1180381283 22:12141199-12141221 TTCCTAATATCCATGTGGAAAGG No data
1180381277_1180381282 11 Left 1180381277 22:12141160-12141182 CCAATATCGCAGTGGGTGTACAC No data
Right 1180381282 22:12141194-12141216 TATTGTTCCTAATATCCATGTGG No data
1180381277_1180381284 17 Left 1180381277 22:12141160-12141182 CCAATATCGCAGTGGGTGTACAC No data
Right 1180381284 22:12141200-12141222 TCCTAATATCCATGTGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180381277 Original CRISPR GTGTACACCCACTGCGATAT TGG (reversed) Intergenic
No off target data available for this crispr