ID: 1180381282

View in Genome Browser
Species Human (GRCh38)
Location 22:12141194-12141216
Sequence TATTGTTCCTAATATCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180381276_1180381282 12 Left 1180381276 22:12141159-12141181 CCCAATATCGCAGTGGGTGTACA No data
Right 1180381282 22:12141194-12141216 TATTGTTCCTAATATCCATGTGG No data
1180381277_1180381282 11 Left 1180381277 22:12141160-12141182 CCAATATCGCAGTGGGTGTACAC No data
Right 1180381282 22:12141194-12141216 TATTGTTCCTAATATCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180381282 Original CRISPR TATTGTTCCTAATATCCATG TGG Intergenic
No off target data available for this crispr