ID: 1180381284

View in Genome Browser
Species Human (GRCh38)
Location 22:12141200-12141222
Sequence TCCTAATATCCATGTGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180381278_1180381284 -5 Left 1180381278 22:12141182-12141204 CCCACCCTGTGATATTGTTCCTA No data
Right 1180381284 22:12141200-12141222 TCCTAATATCCATGTGGAAAGGG No data
1180381280_1180381284 -9 Left 1180381280 22:12141186-12141208 CCCTGTGATATTGTTCCTAATAT No data
Right 1180381284 22:12141200-12141222 TCCTAATATCCATGTGGAAAGGG No data
1180381277_1180381284 17 Left 1180381277 22:12141160-12141182 CCAATATCGCAGTGGGTGTACAC No data
Right 1180381284 22:12141200-12141222 TCCTAATATCCATGTGGAAAGGG No data
1180381281_1180381284 -10 Left 1180381281 22:12141187-12141209 CCTGTGATATTGTTCCTAATATC No data
Right 1180381284 22:12141200-12141222 TCCTAATATCCATGTGGAAAGGG No data
1180381276_1180381284 18 Left 1180381276 22:12141159-12141181 CCCAATATCGCAGTGGGTGTACA No data
Right 1180381284 22:12141200-12141222 TCCTAATATCCATGTGGAAAGGG No data
1180381279_1180381284 -6 Left 1180381279 22:12141183-12141205 CCACCCTGTGATATTGTTCCTAA No data
Right 1180381284 22:12141200-12141222 TCCTAATATCCATGTGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180381284 Original CRISPR TCCTAATATCCATGTGGAAA GGG Intergenic
No off target data available for this crispr