ID: 1180383427

View in Genome Browser
Species Human (GRCh38)
Location 22:12162589-12162611
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180383427_1180383436 15 Left 1180383427 22:12162589-12162611 CCTGGGCAGCCTCTGGATCGCGG No data
Right 1180383436 22:12162627-12162649 GAGCCTGCCAGACCCTGTCCCGG No data
1180383427_1180383438 20 Left 1180383427 22:12162589-12162611 CCTGGGCAGCCTCTGGATCGCGG No data
Right 1180383438 22:12162632-12162654 TGCCAGACCCTGTCCCGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180383427 Original CRISPR CCGCGATCCAGAGGCTGCCC AGG (reversed) Intergenic
No off target data available for this crispr