ID: 1180383433

View in Genome Browser
Species Human (GRCh38)
Location 22:12162616-12162638
Sequence TCTGGCAGGCTCTCAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180383433_1180383449 30 Left 1180383433 22:12162616-12162638 CCCTGGCCTGAGAGCCTGCCAGA No data
Right 1180383449 22:12162669-12162691 GAACTCCACATCTCTATCCAGGG No data
1180383433_1180383438 -7 Left 1180383433 22:12162616-12162638 CCCTGGCCTGAGAGCCTGCCAGA No data
Right 1180383438 22:12162632-12162654 TGCCAGACCCTGTCCCGGCCCGG No data
1180383433_1180383448 29 Left 1180383433 22:12162616-12162638 CCCTGGCCTGAGAGCCTGCCAGA No data
Right 1180383448 22:12162668-12162690 AGAACTCCACATCTCTATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180383433 Original CRISPR TCTGGCAGGCTCTCAGGCCA GGG (reversed) Intergenic
No off target data available for this crispr